Salih Ulu Blog

BİLİM, EĞİTİM, TEKNOLOJİ, HOBİ

salih-MacBook-Pro:~ simacpro$ flexbar -r flexbar/test/test.fasta -a flexbar/test/adapters.fasta -ao 5 -l ALL

________ __
/ ____/ /__ _ __/ /_ ____ ______
/ /_ / / _ \| |/ / __ \/ __ `/ ___/
/ __/ / / __/> /_/ /_/\___/_/|_/_.___/\__,_/_/

Flexbar – flexible barcode and adapter removal, version 2.5

Local time: Wed Jul 8 11:09:56 2015

Target name: flexbar
File type: fasta
Reads file: flexbar/test/test.fasta
Adapter file: flexbar/test/adapters.fasta

threads: 1
max-uncalled: 0
min-read-length: 18

adapter-trim-end: RIGHT
adapter-min-overlap: 5
adapter-threshold: 3
adapter-match: 1
adapter-mismatch: -1
adapter-gap: -6

Adapter: Sequence:
ad1 CGTCTT

Processing reads …

Log level ALL output generation:

Sequence removal: right side
query tag ad1
read tag left_tail:shouldnt work – right_tail:shouldnt work – rigth:end with ATGC – left:discarded(C)
read TGAGATCGTTCAGTACGGCAATCGTATGCCGTCTTC
read pos 0-36
query pos 29-35
score 6
overlap 6
errors 0
allowed errors 1.8
remaining read TGAGATCGTTCAGTACGGCAATCGTATGC

Alignment:

0 . : . : . : .
TGAGATCGTTCAGTACGGCAATCGTATGCCGTCTTC
||||||
—————————–CGTCTT-

Sequence removal: right side
query tag ad1
read tag left_tail:shouldnt work – right_tail:end with ATGC – right:end_with_ATGC – left:discarded_empty_read(N)
read TGAGATCGTTCAGTACGGCAATTCGTATGCCGTCTT
read pos 0-36
query pos 30-36
score 6
overlap 6
errors 0
allowed errors 1.8
remaining read TGAGATCGTTCAGTACGGCAATTCGTATGC

Alignment:

0 . : . : . : .
TGAGATCGTTCAGTACGGCAATTCGTATGCCGTCTT
||||||
——————————CGTCTT

Sequence removal: right side
query tag ad1
read tag left_tail:shouldnt work – right_tail:shouldnt work – right:should_end_with_TGC-left:Discarded(T)
read TGAGATCGTTCAGTACGGCAATCGTATGCCGTCTTT
read pos 0-36
query pos 29-35
score 6
overlap 6
errors 0
allowed errors 1.8
remaining read TGAGATCGTTCAGTACGGCAATCGTATGC

Alignment:

0 . : . : . : .
TGAGATCGTTCAGTACGGCAATCGTATGCCGTCTTT
||||||
—————————–CGTCTT-

Sequence removal: right side
query tag ad1
read tag left_tail:shouldnt work – right_tail:end with CAC – right:end_with_A_left:discarded_empty_read(N)
read TCACCGGGTGGAAACTAGCCCCCCCCCCCACCGTCT
read pos 0-36
query pos 31-37
score 5
overlap 5
errors 0
allowed errors 1.5
remaining read TCACCGGGTGGAAACTAGCCCCCCCCCCCAC

Alignment:

0 . : . : . : .
TCACCGGGTGGAAACTAGCCCCCCCCCCCACCGTCT-
|||||
——————————-CGTCTT

Sequence removal: right side
query tag ad1
read tag left:begin_with_G-left_tail:should_work(begin with G) – right_tail:shouldnt work – right:discarded
read CGTCTTGAAAAAAACCCCCCCCCCTTTTTTTTTTTT
read pos 0-36
query pos 0-6
score 6
overlap 6
errors 0
allowed errors 1.8
remaining read

Alignment:

0 . : . : . : .
CGTCTTGAAAAAAACCCCCCCCCCTTTTTTTTTTTT
||||||
CGTCTT——————————

No valid alignment:
read tag left:begin_with_G-left_tail:should_work(begin with A) – right_tail:shouldnt work – right:discarded
read GTCTTAAAAAAACCCCCCCCCCTTTTTTTTTTTTTT

Sequence removal: right side
query tag ad1
read tag left_tail:sholdnt_work – right_tail:shouldnt work – right:10bp_remain
read AAAAAAAAAACGTCTTCATTATACAGAACACAGCAT
read pos 0-36
query pos 10-16
score 6
overlap 6
errors 0
allowed errors 1.8
remaining read AAAAAAAAAA

Alignment:

0 . : . : . : .
AAAAAAAAAACGTCTTCATTATACAGAACACAGCAT
||||||
———-CGTCTT——————–

Sequence removal: right side
query tag ad1
read tag left_tail:shouldnt work – right_tail:shouldnt work – right:discarded
read AAAAAAAAACGTCTTCATTATACAGAACACAGCAT
read pos 0-35
query pos 9-15
score 6
overlap 6
errors 0
allowed errors 1.8
remaining read AAAAAAAAA

Alignment:

0 . : . : . : .
AAAAAAAAACGTCTTCATTATACAGAACACAGCAT
||||||
———CGTCTT——————–

Sequence removal: right side
query tag ad1
read tag left_tail:shouldnt work – right_tail:shouldnt work – both:right_remains
read TGGAAGCCCCAGCGTCTTAAAAAATTTTTTAAAAAA
read pos 0-36
query pos 12-18
score 6
overlap 6
errors 0
allowed errors 1.8
remaining read TGGAAGCCCCAG

Alignment:

0 . : . : . : .
TGGAAGCCCCAGCGTCTTAAAAAATTTTTTAAAAAA
||||||
————CGTCTT——————

Sequence removal: right side
query tag ad1
read tag left_tail:shouldnt work – right_tail:shouldnt work – both:left_remains-left:10bp
read TGGAAAAAAAAAAGCCCCAGCGTCTTAAAAAATTTT
read pos 0-36
query pos 20-26
score 6
overlap 6
errors 0
allowed errors 1.8
remaining read TGGAAAAAAAAAAGCCCCAG

Alignment:

0 . : . : . : .
TGGAAAAAAAAAAGCCCCAGCGTCTTAAAAAATTTT
||||||
——————–CGTCTT———-

Sequence removal: right side
query tag ad1
read tag left_tail:shouldnt work – right_tail:shouldnt work – both:left_remains-left:Discarded_9bp
read TGGAAAAAAAAAAAGCCCCAGCGTCTTAAAAATTTT
read pos 0-36
query pos 21-27
score 6
overlap 6
errors 0
allowed errors 1.8
remaining read TGGAAAAAAAAAAAGCCCCAG

Alignment:

0 . : . : . : .
TGGAAAAAAAAAAAGCCCCAGCGTCTTAAAAATTTT
||||||
———————CGTCTT———

done.

Computation time: < 1 sec

Adapter removal statistics
==========================
Adapter: Overlap removal: Full length:
ad1 10 9

Min, max, mean and median adapter overlap: 5 / 6 / 5 / 6

Output file statistics
======================
Read file: flexbar.fasta
written reads 7
skipped short reads 6

Filtering statistics
====================
Processed reads 13
skipped due to uncalled bases 0
short prior adapter removal 2
finally skipped short reads 6
Discarded reads overall 6
Remaining reads 7 (53% of input)

Processed bases: 422
Remaining bases: 196 (46% of input)

Flexbar completed adapter removal.

Categories: Bioinformatics, Flexbar

Leave a Reply